View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1363_low_11 (Length: 252)
Name: NF1363_low_11
Description: NF1363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1363_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 57 - 244
Target Start/End: Complemental strand, 37290919 - 37290734
Alignment:
| Q |
57 |
taactatcttatttgttatatgggcactaacgttaagtgaatannnnnnnnnnnnatcaatcaaataaatattattaaactaatcaggatgtattctcaa |
156 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37290919 |
taactatgttatttgttatatgggcactaatgttaaatgaatatttttttttt--atcaatcaaataaatattattaaactaatcaggatgcattctcaa |
37290822 |
T |
|
| Q |
157 |
tattatattattattgggttatccttaaaaacaaaagaatattcgttttaaatctattattattgtacgtattatagatcttcatctc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37290821 |
tattatattattattgggttatccttaaaaacaaaagaatattcgttttaaatctattattattgtacgtattatagatcttcatctc |
37290734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 38 - 73
Target Start/End: Complemental strand, 37291096 - 37291061
Alignment:
| Q |
38 |
ttgaaagaaaacattattgtaactatcttatttgtt |
73 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37291096 |
ttgaaagaaaacattattgtaactatgttatttgtt |
37291061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University