View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1363_low_16 (Length: 201)
Name: NF1363_low_16
Description: NF1363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1363_low_16 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 16 - 201
Target Start/End: Complemental strand, 4665146 - 4664961
Alignment:
| Q |
16 |
aggcagctgaaaaagttttgggaactgaaggtctagaaaatatcaaagttgttggttgcaggaatatgaaggacgttatcaacactatatttcctaatgt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4665146 |
aggcagctgaaaaagttttgggaactgaaggtctagaaaatatcaaagttgttggttgcaggaatctgaaggacgttatcaacactatatttcctaatgt |
4665047 |
T |
|
| Q |
116 |
gatgagaagaagcaagtaaattgtcaccctagggtgtttgtgttgtgtcgatacctatatacatttgtaaatgtgttatgtaaaat |
201 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4665046 |
gatgagaagaagcaagtaaattgtcacactagggtgtttgtgttgtggagatacctatataaatttgtaaatgtgttatgtaaaat |
4664961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 26 - 88
Target Start/End: Original strand, 43267526 - 43267588
Alignment:
| Q |
26 |
aaaagttttgggaactgaaggtctagaaaatatcaaagttgttggttgcaggaatatgaagga |
88 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| ||||| || ||||||| |||| ||||||| |
|
|
| T |
43267526 |
aaaagctttaggaactgaaggtctagaaaatattaaagtagtaggttgcaagaatctgaagga |
43267588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University