View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1363_low_3 (Length: 402)
Name: NF1363_low_3
Description: NF1363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1363_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 29 - 293
Target Start/End: Original strand, 14509378 - 14509641
Alignment:
| Q |
29 |
aataatttggccaaatgaccatgtatgttaatcactttcgatgcattttccattatttctcttttgactactcacttgtatgggacaataactggtagag |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
14509378 |
aataatttggccaaatgaccatgtatgttaatcactttcgatgcattttccattatttctcttttgactactcacttgtatgggacaataattcgtagag |
14509477 |
T |
 |
| Q |
129 |
aaatcatatatatatgacatgattctttgttggtttcacatgttcatcaaacaaaataaatattcttgtaaccnnnnnnnnnnnncaataaatattcatt |
228 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
14509478 |
aaatcatatatctatgacatgattctttgttggtttcacatgctcatcaaacaaaataaatattcttgtaa-caaaaaaaaaacaaaataaatattcatt |
14509576 |
T |
 |
| Q |
229 |
ctttgttttactttgatgagcaatatgtatcggaaaccaacgaagaatcatgtcctattaatttt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
14509577 |
ctttgttttactttgatgagcaatatgtatccgaaaccaacaaagaatcatgtcctattaatttt |
14509641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 351 - 402
Target Start/End: Original strand, 14509645 - 14509696
Alignment:
| Q |
351 |
tcacttcttgcaatgaccaaaatgccaaatacattttgataatgattggcac |
402 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14509645 |
tcacctcttacaatgaccaaaatgccaaatacattttgataatgattggcac |
14509696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University