View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1363_low_6 (Length: 363)
Name: NF1363_low_6
Description: NF1363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1363_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 78 - 215
Target Start/End: Original strand, 28974818 - 28974954
Alignment:
| Q |
78 |
tacagttaacaacaaaagacctttgaaaagaaacagtgatataaaaataaaatacctttgattatattctctatagttttggacacaaatttatataaga |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||| ||||||||||||||| | ||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
28974818 |
tacagttaacaacaaaagacctttgaaaagaaacaataatataatgataaaatacctttgagtgtat-ctctatagttttgtacacaaatttatataaga |
28974916 |
T |
|
| Q |
178 |
cgttgcaaaggaaaattggtgtgaaatcacctttgatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28974917 |
cgttgcaaaggaaaattggtgtgaaatcacctttgatt |
28974954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University