View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1363_low_8 (Length: 305)
Name: NF1363_low_8
Description: NF1363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1363_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 35 - 294
Target Start/End: Original strand, 48614028 - 48614288
Alignment:
| Q |
35 |
agatgaacacaaaggaca-tgcccaactagctactaggataactgaataaaatgattcgataccatgaactagccagttacatacttcgtcacctcactc |
133 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48614028 |
agataaacacaaaggacactgcccaactagctactaggataactgaataaaatgatttgataccatgaactagccagttacatacttcgtcacctcactc |
48614127 |
T |
|
| Q |
134 |
ttgaaaacatggctaatactcctcaacttgaaggatctctttggtaacatcgactacttcctcaacttcaatgtccttggcttcatattcctcttcctcg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48614128 |
ttgaaaacatggctaatactcctcaacttgaaggatctctttggtaacatcgactacttcctcaacttcaatgtccttggcttcatattcctcttcctcg |
48614227 |
T |
|
| Q |
234 |
tcactagcttctccgtccctcagattttccctctctagcttctcttcttcatgcaacagct |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48614228 |
tcactagcttctccgtccctcagattttccctctctagcttctcttcttcatgcaacagct |
48614288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 74; Significance: 6e-34; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 162 - 294
Target Start/End: Complemental strand, 19726055 - 19725920
Alignment:
| Q |
162 |
tgaaggatctctttggtaacatcgactacttcctca---acttcaatgtccttggcttcatattcctcttcctcgtcactagcttctccgtccctcagat |
258 |
Q |
| |
|
|||||||| |||||| |||| |||||||||||||| |||||||||||||| || |||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
19726055 |
tgaaggatttctttgttaacttcgactacttcctcctcgacttcaatgtcctttgcctcatattcctcttccttgtcactagcttctctgtccctcagat |
19725956 |
T |
|
| Q |
259 |
tttccctctctagcttctcttcttcatgcaacagct |
294 |
Q |
| |
|
||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
19725955 |
tttgactctctaacttctcttcttcatgcatcagct |
19725920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University