View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364-INSERTION-3 (Length: 204)
Name: NF1364-INSERTION-3
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364-INSERTION-3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 70; Significance: 9e-32; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 12 - 98
Target Start/End: Original strand, 39136508 - 39136590
Alignment:
| Q |
12 |
cttcttctgtctccagtgtccctctgtttttctactcactcacctttgacacaatacccacactttttaaagagagacaaaaatcag |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39136508 |
cttcttctgtctccagtgtccctctgtttttctactc----acctttgacacaatacccacactttttaaagagagacaaaaatcag |
39136590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 164 - 203
Target Start/End: Original strand, 39136668 - 39136707
Alignment:
| Q |
164 |
aattcaatgggagaaaccttaaaccctactgctccagagt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39136668 |
aattcaatgggagaaaccttaaaccctactgctccagagt |
39136707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University