View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364-INSERTION-4 (Length: 258)
Name: NF1364-INSERTION-4
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364-INSERTION-4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 10 - 222
Target Start/End: Original strand, 9607732 - 9607939
Alignment:
| Q |
10 |
tatatcatctaaataaatctctcacatttttatacatggaacacattccctttaccctctgtcttttgtatatcattgtaatgttttctattaatctcaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9607732 |
tatatcatctaaataaatctctcacatttttatacatggaacacattccctttaccctctgtcttttgtatatcattgtaatgttttctattaatctcaa |
9607831 |
T |
|
| Q |
110 |
atacactctacttcagatttggtctcttctactaaaagattccattgtgaatgcttattttaaattaatcaaagacgaatctgtttgatggaatttaaat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9607832 |
atacactctacttcagatttggtctcttctactaaaagattccattgtgaatgcttatt-----ttaatcaaagacgaatctgtttgatggaatttaaat |
9607926 |
T |
|
| Q |
210 |
ccactgtctttgt |
222 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
9607927 |
ccactgtgtttgt |
9607939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 214 - 252
Target Start/End: Original strand, 9608045 - 9608083
Alignment:
| Q |
214 |
tgtctttgtcggagtgataaagttatctaaaatgtgtgt |
252 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9608045 |
tgtcattgtcggagtgataaagttatctaaaatgtgtgt |
9608083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University