View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13640_high_2 (Length: 411)
Name: NF13640_high_2
Description: NF13640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13640_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 7e-96; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 7e-96
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 4366231 - 4366050
Alignment:
| Q |
1 |
ccttaattctccctatgtgggcagcaacttagaaggagaagaagtaattagagatgaagagaagtcacgagaatggaagcttggaattgtagagatcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4366231 |
ccttaattctccctatgtgggcagcaacttagaaggagaagaagtaattagagatgaagagaagtcacgagaatggaagcttggaattgtagagatcaaa |
4366132 |
T |
 |
| Q |
101 |
gtcaatttggaaatttcatcaatctcttcttaagagagcctaaggtaacatagaatcccttccctaaaacatctatagggtg |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4366131 |
gtcaatttggaaatttcatcaatctcttcttaagagagcctaaggtaacatagaatcccttccttaaaacatctatagggtg |
4366050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 251 - 395
Target Start/End: Complemental strand, 4366051 - 4365907
Alignment:
| Q |
251 |
tgattgaatgtttgttgttgtgagctgatttttattgcatacaaaatgataattagtttgcatgttgtttttaattgagtttgatgggtatgagttagtt |
350 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4366051 |
tgattgaatgtttgttgttatgagatgatttttgttgcatacaaaatgataattagtttgcatgttgtttttaattgagtttgatgggtatgagttagtt |
4365952 |
T |
 |
| Q |
351 |
tataactgaaataaatcattacggagatgaacttgaagtttggtt |
395 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4365951 |
tataactgaaataaatcattacggatatgaacttgaagtttggtt |
4365907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University