View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13640_high_3 (Length: 410)
Name: NF13640_high_3
Description: NF13640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13640_high_3 |
 |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0085 (Bit Score: 376; Significance: 0; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 22 - 401
Target Start/End: Complemental strand, 45545 - 45166
Alignment:
| Q |
22 |
cagattaaaattgactttaagaaaaatgtaattgaggaaatagtatttgcaactttttggatactaagaagcaaacctagtttttgtttaagcatgacag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45545 |
cagattaaaattgactttaagaaaaatgtaattgaggaaatagtatttgcaactttttggatactaagaagcaaacctagtttttgtttaagcatgacag |
45446 |
T |
 |
| Q |
122 |
gggttttatagaaaaaggctgtttactgaaatttggattgttatatcaaggtttttgatgtctttatgatcgcatagaagtatatttaacaattattctc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45445 |
gggttttatagaaaaaggctgtttactgaaatttggattgttatatcaaggtttttgatgtctttatgatcgcatagaagtatatttaacaattattctc |
45346 |
T |
 |
| Q |
222 |
tgtaatatcgtggattatgtcgtgatcgcaatttaaaactttgcgcacggagaattgcttgaaaatttggtttttggatgatgcagaccaattcaaattg |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45345 |
tgtaatatcgtggattatgtcgtgatcgcaatttaaaactttgcgcacggagaattgcttgaaaatttggtttttggatgatgcagaccaattcaaattg |
45246 |
T |
 |
| Q |
322 |
cacaaattcttcattctcagggacggaatcatgtcggcacttgtgcaggcccgtgcccccactttgtttctgatattctt |
401 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45245 |
cacaaattcttcattctcagggacggaatcatgtcggcacttgtgcaggcccgtgcccccactttgtttctgattttctt |
45166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University