View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13640_high_6 (Length: 267)
Name: NF13640_high_6
Description: NF13640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13640_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 7 - 235
Target Start/End: Complemental strand, 6319949 - 6319721
Alignment:
| Q |
7 |
gtatctccttcatcagtttcttgatcagctgatagtattgactgccttttgcgatcatcatcgccgcttgaagggctactcataccactcaatatgcctg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6319949 |
gtatctccttcatcagtttcttgatcagctgacagtattgactgccttttgcgatcatcatcgccgcttgaagggctactcataccactcaatatgcctg |
6319850 |
T |
 |
| Q |
107 |
ttttgtgatcgccatcatcttcgcttaaagcgctattcatgactctcaatatgtgagttttgtgatcaccatagtgttcgcttgaagtgctactcatgaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6319849 |
ttttgtgatcgccatcatcttcgcttaaagcgctattcatgactctcaatatgtgagttttgtgatcaccatagtgttcgcttgaagtgctactcatgaa |
6319750 |
T |
 |
| Q |
207 |
tctcaatatgcttgaagatccaagaagaa |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6319749 |
tctcaatatgcttgaagatccaagaagaa |
6319721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University