View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13640_high_7 (Length: 266)
Name: NF13640_high_7
Description: NF13640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13640_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 7e-58; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 10 - 131
Target Start/End: Complemental strand, 42507671 - 42507550
Alignment:
| Q |
10 |
aacaaaatcaatatagcaattatgcaataccctaaggcctccggtagaaccatgttgcctagttattaatgagaatcgatccacaccaaccaacatctag |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42507671 |
aacagaatcaatatagcaattatgcaataccctaaggcctccggtagaaccatgttgcctagttattaatgagaatcgatccacaccaaccaacatctat |
42507572 |
T |
 |
| Q |
110 |
aaaagaaaattggtttatttta |
131 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42507571 |
aaaagaaaattggtttatttta |
42507550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 10 - 131
Target Start/End: Complemental strand, 42523844 - 42523723
Alignment:
| Q |
10 |
aacaaaatcaatatagcaattatgcaataccctaaggcctccggtagaaccatgttgcctagttattaatgagaatcgatccacaccaaccaacatctag |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42523844 |
aacagaatcaatatagcaattatgcaataccctaaggcctccggtagaaccatgttgcctagttattaatgagaatcgatccacaccaaccaacatctat |
42523745 |
T |
 |
| Q |
110 |
aaaagaaaattggtttatttta |
131 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42523744 |
aaaagaaaattggtttatttta |
42523723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 10 - 131
Target Start/End: Complemental strand, 42517190 - 42517071
Alignment:
| Q |
10 |
aacaaaatcaatatagcaattatgcaataccctaaggcctccggtagaaccatgttgcctagttattaatgagaatcgatccacaccaaccaacatctag |
109 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||| ||||| |||||||||||||||| |||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
42517190 |
aacagaatcaatatagcaactatgcaataccctaagtcctccaatagaaccatgttgcctcgttattaaagaaaatcgatcaacaccaaccaacatctac |
42517091 |
T |
 |
| Q |
110 |
aaaagaaaattggtttatttta |
131 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
42517090 |
aaa--aaaattggtttatttta |
42517071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University