View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13640_high_9 (Length: 236)

Name: NF13640_high_9
Description: NF13640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13640_high_9
NF13640_high_9
[»] chr8 (1 HSPs)
chr8 (127-184)||(39870681-39870737)


Alignment Details
Target: chr8 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 127 - 184
Target Start/End: Original strand, 39870681 - 39870737
Alignment:
127 tagaggtactttagtataacaaacatttatgctgaagcttaggggggcgtaactagaa 184  Q
    |||||||| ||| |||||||||||||||||||||||||||| ||||||||||||||||    
39870681 tagaggtatttttgtataacaaacatttatgctgaagctta-gggggcgtaactagaa 39870737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University