View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13640_low_12 (Length: 211)
Name: NF13640_low_12
Description: NF13640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13640_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 15 - 193
Target Start/End: Original strand, 33068726 - 33068918
Alignment:
| Q |
15 |
cagagagcaggttttgtctttctgattgagtattaaccacttcactacaaaattttatgtctggaaaatgggaaggactagtaatgggtacagcta---- |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33068726 |
cagagagcaggttttgtctttctgattgagtattaaccacttcactacaaaattttatgtctggaaaatgagaaggactagtaatgggtacagctaagct |
33068825 |
T |
 |
| Q |
111 |
----------agcatcttcttctatatatgtgcttacttgtttgtgactcttgtgggatctgagttgagtggatctaatctaatggtagtaaa |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33068826 |
agcctattatagcatcttcttctatatatgtgcttacttgtttgtgactcttgtgggatctgagttgagtggatctaatctaatggtagtaaa |
33068918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University