View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13640_low_15 (Length: 202)
Name: NF13640_low_15
Description: NF13640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13640_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 11 - 122
Target Start/End: Original strand, 35258445 - 35258556
Alignment:
| Q |
11 |
ggtagattattctcttaatacagaacatggttttaattagcaggctgtaacaacaaaattgcaactacaatataaaggattttgaagtctatgaacagct |
110 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35258445 |
ggtatatttttctcttaatacagaacatggttttaattagcaggctgtaacaacaaaattgcaactacaatataaaggattttgaagtctatgaacagct |
35258544 |
T |
|
| Q |
111 |
tcaaccgcattt |
122 |
Q |
| |
|
|||||||||||| |
|
|
| T |
35258545 |
tcaaccgcattt |
35258556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 35258578 - 35258635
Alignment:
| Q |
119 |
atttaaaaccatgtagcaacaacatctaatactagccaaattgtaatacaaaattggt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35258578 |
atttaaaaccatgtagcaacaacatctaatactagccaaattgtaatacataattggt |
35258635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University