View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13640_low_8 (Length: 239)
Name: NF13640_low_8
Description: NF13640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13640_low_8 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 39870290 - 39870053
Alignment:
| Q |
1 |
tatgttaattcacacccccaaccaaaccctaaaaacttaaattcccaacaccaaagttgtaaaggcaaaacctaggatnnnnnnnn-gtcaaaaaggaga |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
39870290 |
tatgttaattcacacccccaaccaaaccctaaaaacttaaattcccaacaccaaagttttaaaggcaaaacctaggataaaaaaaaagtcaaaaaggaga |
39870191 |
T |
|
| Q |
100 |
ttcttctgttaagaaatcaatcactaaaatcaaagcttccactctgtgaactactgccattgagactatgtaaagagaggcctctgatgtggctagccaa |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39870190 |
ttcttctgttaagaaatcaatcgctaaaatcaaagcttccactctg--aactactgccattgcgactatgtaaagagaggcctctgatgtggctagccaa |
39870093 |
T |
|
| Q |
200 |
agtgccgctgtccttattatgctgaaaatattcttctctc |
239 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
39870092 |
agtgccactgtccttattatgctgaaaatatttttctctc |
39870053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University