View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13641_low_9 (Length: 211)
Name: NF13641_low_9
Description: NF13641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13641_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 12 - 192
Target Start/End: Complemental strand, 44691104 - 44690928
Alignment:
| Q |
12 |
atcatcataactaattcatctctcatttatcgtttatnnnnnnnntcatgatgcattaatgcccatagagggctgctcttgttatggtgaggaacaacta |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
44691104 |
atcatcataactaattcatctctcatttatcgtttataaaaaaaatcatgatgcattaatgcccatagagggctgctct----atgttgaggaacaacta |
44691009 |
T |
 |
| Q |
112 |
ggatttaactatattcttcccaggatgaagataacaagagctgcgagtttaatgctggatcttttcttgtagaggaagctc |
192 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44691008 |
ggatttaactatattctccccaggatgaagataacaagaactgcgagtttaatgctggatcttttcttgtagaggaagctc |
44690928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University