View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13642_high_4 (Length: 243)
Name: NF13642_high_4
Description: NF13642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13642_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 21 - 232
Target Start/End: Original strand, 6340787 - 6341000
Alignment:
| Q |
21 |
gcgaatttcccggggcaataatgcaatgaaaagagcacccaattgcagtgcttggccccaaagatgttcaaaactagactattagtgt--gaagagaaaa |
118 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6340787 |
gcgaatttaccggggcaataatgcaatgagaagagcacccaattgcagtgcttggccccaaagatgttcaaaactagactattagtgtgtgaagagaaaa |
6340886 |
T |
 |
| Q |
119 |
gcaaaagaagaaaaacatgatatctcagtatgtccagttatattcaaatttgttataatacaatgtcaattgttgattgaaactagagattagttcaggt |
218 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6340887 |
acaaaagaagaaaaacatgatttctcagtatgtccagttatattcaaatttgttataatacaatgtcaattgttgattgaaactagagattagttcaggt |
6340986 |
T |
 |
| Q |
219 |
agcagatgatgtcc |
232 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6340987 |
agcagatgatgtcc |
6341000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University