View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13642_low_5 (Length: 241)
Name: NF13642_low_5
Description: NF13642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13642_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 39 - 222
Target Start/End: Original strand, 19343908 - 19344091
Alignment:
| Q |
39 |
ggacattaggagctacaatataaggttcagtagcagagtgtccacttctacacaaatgatgaaggagaattgagcatcttccaggtgcctgttgtccaat |
138 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19343908 |
ggacattatgagctacaatataaggttcagtagcagagtttccacttctacacaaatgatgaaggagaattgagcatcttccaggtggttgttgtccaat |
19344007 |
T |
 |
| Q |
139 |
atcataccccatccaagcaaatgtatgaggttcattgaatgttatccaatgtttcaccctgtctccaaatttctcaaagcatgt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19344008 |
atcataccccatccaagcaaatgtatgaggttcattgaatgttatccaatgtttcaccctgtctccaaatttctcaaagcatgt |
19344091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University