View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13643_low_11 (Length: 238)
Name: NF13643_low_11
Description: NF13643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13643_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 73 - 224
Target Start/End: Original strand, 37243379 - 37243530
Alignment:
| Q |
73 |
atatcaaaagattaagttgctgaatttttatatgtaattggtttttgcatgtgatatataggtttgggatgtgatctctaatcaagaagcagtggatatt |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37243379 |
atatcaaaagattaagttgctgaatttttatatgtaattggtttttgcatgtgatatataggtttgggatgtgatctctaatcaagaagcagtggatatt |
37243478 |
T |
|
| Q |
173 |
gtgtcttcaacagaagacagaacaagttcatctaaacgtttggtggagtgtg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37243479 |
gtgtcttcaacagaagacagaacaagttcatctaaacgtttggtggagtgtg |
37243530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 37243243 - 37243317
Alignment:
| Q |
1 |
gtgataagttttttactgacctgacatggaatcggctgacgcggaatcatccaatttggtgaaatagtaaaaata |
75 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37243243 |
gtgataagttttttactgacctgacatagaatcggctgacgcggaatcatccaatttggtgaaatagtaaaaata |
37243317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 132 - 216
Target Start/End: Complemental strand, 46256274 - 46256190
Alignment:
| Q |
132 |
aggtttgggatgtgatctctaatcaagaagcagtggatattgtgtcttcaacagaagacagaacaagttcatctaaacgtttggt |
216 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || ||||| ||||||||| ||||| | ||| ||| ||||||||||||| |
|
|
| T |
46256274 |
aggtttgggatgtgatctccaatcaagaagcagtagacattgtatcttcaacaccagacaaagcaaaatcagctaaacgtttggt |
46256190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University