View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13643_low_9 (Length: 252)
Name: NF13643_low_9
Description: NF13643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13643_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 44 - 234
Target Start/End: Original strand, 25158117 - 25158307
Alignment:
| Q |
44 |
tatgttcaattttataccaaaatgaaacatgacttaagccacattgatatttttatcgagcgtgagttaactcatgttggatcaagacttaactcatgtt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||||||||||||||| ||| ||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
25158117 |
tatgttcaattttataccaaaatgaaacgtgactgaagccacattgatatttttaccgaacgtgagttaactcatgttggatcaaaacttaactcacgtt |
25158216 |
T |
|
| Q |
144 |
ggacatagcaaatgtggcttaagttactttagggttatctttggtagcttctggtgggaatgagctaatttgattgggagaagaacaattt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25158217 |
ggacatagcaaatgtggcttaagttactttagggttatttttggtagtttctggtgggaatgagctaatttgattgggagaagaacaattt |
25158307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University