View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13647_high_2 (Length: 337)
Name: NF13647_high_2
Description: NF13647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13647_high_2 |
 | |
|
| [»] scaffold0110 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0110 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 1 - 320
Target Start/End: Complemental strand, 2541 - 2222
Alignment:
| Q |
1 |
ttaatttgttgagtgagagagcacgagagagagtgcacatgtcttaattgtttccactagcagttgttgcaaactttattcttctcttacatgtcattca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2541 |
ttaatttgttgagtgagagagcacgagagagagtgcacatgtcttaattgtttccaccagcagttgttgcaaactttattcttctcttacatgtcattca |
2442 |
T |
|
| Q |
101 |
taatcatagtaaacaattaatatagctttatcatcttttacttccttttttccaaagagtttagtgacataagtcacac--acactaaatgcatggagcg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
2441 |
taatcatagtaaacaattaatatagctttatcatcttttacttccttttttccaaagagtttagtgacacaagtcacacacacactaaatgcatggagcg |
2342 |
T |
|
| Q |
199 |
gattgaacccacgttccactataatcaactaatcatgcagttgttcaagatgtatgtaaccggttagtataacacactctttattggatgttgatttatt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2341 |
gattgaacccacgttccactataatcaactaaccatgcagttgttcaagatgtatgtaaccggttagtataacaca--ctttattggatgttgatttatt |
2244 |
T |
|
| Q |
299 |
tggaagtctaaaaatgatgaaa |
320 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2243 |
tggaagtctaaaaatgatgaaa |
2222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 241 - 322
Target Start/End: Original strand, 17488227 - 17488311
Alignment:
| Q |
241 |
gttcaagatgtatgtaaccggttagtataacacactcttt---attggatgttgatttatttggaagtctaaaaatgatgaaact |
322 |
Q |
| |
|
|||||| ||| ||| ||| | ||||||||||||||||||| ||||||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
17488227 |
gttcaaaatgcatgcaactgattagtataacacactcttttttattggatgttgatttatttagaagtctagaaatgacgaaact |
17488311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University