View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13649_high_11 (Length: 249)
Name: NF13649_high_11
Description: NF13649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13649_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 35905606 - 35905385
Alignment:
| Q |
19 |
attatgatgctatactcaatggtgttgagatattcaaactcaatgatactgatttgtctggaccaaatcctcaaccttctgatatgatgattgaacatga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35905606 |
attatgatgctatactcaatggtgttgagatattcaaactcaatgatactgatttgtctggaccaaatcctcaaccttctgatatgatgattgaacatga |
35905507 |
T |
 |
| Q |
119 |
caatcaggnnnnnnnnnnnnnnnnnnnnnnnnntggtcataataagagttttgttattggtggtgctgccggtggtgcggcaggttttgcaattgttgct |
218 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35905506 |
caatcaggaaaaaacttttcaaaacaaaaaaaatggtcataataagagttttgttattggtggtgctgccggtggtgcggcaggttttgcaattgttgct |
35905407 |
T |
 |
| Q |
219 |
gctatatgtgttgctgttcatc |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35905406 |
gctatatgtgttgctgttcatc |
35905385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 21 - 97
Target Start/End: Original strand, 47623824 - 47623900
Alignment:
| Q |
21 |
tatgatgctatactcaatggtgttgagatattcaaactcaatgatactgatttgtctggaccaaatcctcaaccttc |
97 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| |||||||| || || |||||||| || |||||||| ||||| |
|
|
| T |
47623824 |
tatgatgctatactcaatggggtggagatattcaagctcaatgacacggacttgtctggccccaatcctcagccttc |
47623900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University