View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13649_low_11 (Length: 249)
Name: NF13649_low_11
Description: NF13649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13649_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 14 - 241
Target Start/End: Complemental strand, 33343891 - 33343672
Alignment:
| Q |
14 |
aaatggggttctgcgggacactgaaataagatctaacttattctcagttactataaaatatagagaattcagtttatttggactgaatttctagacgaga |
113 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33343891 |
aaatggggttctgcgggatactgaaataagatctaacttattctcagttactataaaatatagagaattcagtttatttggactgaatttctagacgaga |
33343792 |
T |
 |
| Q |
114 |
tagaggtataacatcatgttgactacagtattgtcgcattatcgtattaaatatccctacttttgcgatacaatacaaataccaatgaaatgtaccattg |
213 |
Q |
| |
|
|||| ||| |||| ||||||||||||| |||||| || ||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33343791 |
tagaagtagaacaacatgttgactacactattgttgc--------atttaatatccctacttttacgatacaatacaaataccaatgaaatgtaccattg |
33343700 |
T |
 |
| Q |
214 |
attggcatgtgaggctcacatgccgttt |
241 |
Q |
| |
|
|||||||||||| ||||||||||||||| |
|
|
| T |
33343699 |
attggcatgtgaagctcacatgccgttt |
33343672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University