View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364_high_36 (Length: 311)
Name: NF1364_high_36
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364_high_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 69 - 261
Target Start/End: Original strand, 35146299 - 35146491
Alignment:
| Q |
69 |
cacttttgcttcatgtgaatttcccaaaaatgatcacttctacatttatttcttagacaaatgcatacttcagacattttgatgagttctattggtgaaa |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35146299 |
cacttttgcttcatgtgaatttcccaaaaatgatcacttctacatttatttcttagacaaatgcatacttcagacattttgatgagttctattggtgaaa |
35146398 |
T |
|
| Q |
169 |
gacgttcgagaattccatctaaaatggattcgggaaaattcaaaagagagatgctaacactatttgcaattttcttcattctagtttcctttg |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35146399 |
gacgttcgagaattccatctaaaatggattcgggaaaattcaaaagagagatgctaacactatttgcaattttcttcattctagtttcctttg |
35146491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University