View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364_high_45 (Length: 271)
Name: NF1364_high_45
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364_high_45 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 30 - 142
Target Start/End: Complemental strand, 27138161 - 27138049
Alignment:
| Q |
30 |
gatttagacatgatttaagtagggtaggcataagcgacaatccaataacctaattttaaaaggtaccaaaggttgtggaatgttgctatttattagataa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27138161 |
gatttagacatgatttaagtagggtagggataagcgacaatccaataacctaattttaaaagttaccaaaggttgtggaatgttgctatttattagataa |
27138062 |
T |
|
| Q |
130 |
tgttgttttgcag |
142 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
27138061 |
tattgttttgcag |
27138049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 144 - 265
Target Start/End: Complemental strand, 27137875 - 27137758
Alignment:
| Q |
144 |
gggtttggaagcaattaatcaatctataaactatagacttatgatggtcacaagctcaacgttattcaatagacactatctagaacaaatatgttcctct |
243 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27137875 |
gggtttggaagcaattaatc----tataaactatagacttatgatggtcacaagctcaacgttattcaatagacactatctagaacaaatatgttcctct |
27137780 |
T |
|
| Q |
244 |
aaaagtgtctcatattgttgga |
265 |
Q |
| |
|
||||||||||||| ||| |||| |
|
|
| T |
27137779 |
aaaagtgtctcattttgctgga |
27137758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University