View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364_high_47 (Length: 264)
Name: NF1364_high_47
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364_high_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 15855264 - 15855391
Alignment:
| Q |
1 |
tgtttgcaatgtgaaatttatactgagatagaatcaatatactaactcgaatggttgaagtaatttagattctggtacttac---tcatgatattaatta |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
15855264 |
tgtttgcaatgtgaaatttatactgagatagaatcaatatactaactcgaatggttgaagtaatttagattctggtacttactcatcatgatattaatta |
15855363 |
T |
 |
| Q |
98 |
cgaacaattagtgtcttttggtcttaac |
125 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
15855364 |
cgaacaattagtgtcttttggtcataac |
15855391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 205 - 255
Target Start/End: Original strand, 15855458 - 15855508
Alignment:
| Q |
205 |
tagtcaaatattgttatagtttggatcaaacttggataccccgagtataat |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15855458 |
tagtcaaatattgttatagtttggatcaaacttggataccccgagtataat |
15855508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University