View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364_high_58 (Length: 251)
Name: NF1364_high_58
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364_high_58 |
 |  |
|
| [»] scaffold0459 (1 HSPs) |
 |  |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0459 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 5301 - 5058
Alignment:
| Q |
1 |
tttatttgctttgtctgcagtcacgatttcacgctcacgaagtcaacacatcggtagccattaaatcgagatcgcacgttgcagatttcaagctcgatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5301 |
tttatttgctttgtctgcagtcacgatttcacgctcacgaagtcaacacatcggtagccattaaatcgagatcgcacgttgcagatttcaagctcgatat |
5202 |
T |
 |
| Q |
101 |
tttagagtgnnnnnnnntcaaaacctgcttgctttctacaccgttcgaacccgatccaaggactaccgatgtgttgacttcatgaatgtgtgggattgtg |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5201 |
tttagagtgaaaaaaaatcaaaacctgcttgctttctacaccgttcgaacccgatccaaggactaccgatgtgttgacttcatgaatgtgtgggattgtg |
5102 |
T |
 |
| Q |
201 |
attgcatgcaatccgaagccttttcaatatgttatttcatctca |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5101 |
attgcatgcaatccgaagccttttcaatatgttatttcatctca |
5058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 5301 - 5058
Alignment:
| Q |
1 |
tttatttgctttgtctgcagtcacgatttcacgctcacgaagtcaacacatcggtagccattaaatcgagatcgcacgttgcagatttcaagctcgatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5301 |
tttatttgctttgtctgcagtcacgatttcacgctcacgaagtcaacacatcggtagccattaaatcgagatcgcacgttgcagatttcaagctcgatat |
5202 |
T |
 |
| Q |
101 |
tttagagtgnnnnnnnntcaaaacctgcttgctttctacaccgttcgaacccgatccaaggactaccgatgtgttgacttcatgaatgtgtgggattgtg |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5201 |
tttagagtgaaaaaaaatcaaaacctgcttgctttctacaccgttcgaacccgatccaaggactaccgatgtgttgacttcatgaatgtgtgggattgtg |
5102 |
T |
 |
| Q |
201 |
attgcatgcaatccgaagccttttcaatatgttatttcatctca |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5101 |
attgcatgcaatccgaagccttttcaatatgttatttcatctca |
5058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University