View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364_high_64 (Length: 245)
Name: NF1364_high_64
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364_high_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 86 - 224
Target Start/End: Original strand, 18504865 - 18505007
Alignment:
| Q |
86 |
gtaattaaacatgtcaagtgagatggaggaagaaattgtttgtttgggagggagaacttagtcgtgaagttggttggggttcatcttcatatcgagggtc |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| | |||||||||| |||| |||||||| |
|
|
| T |
18504865 |
gtaattaaacatgtcaagtgagatggaggaagagattggttgtttgggagggagaacttagtcgtgaagttgttaggggttcatccccataccgagggtc |
18504964 |
T |
 |
| Q |
186 |
----tttctggtattgaaagtaaagctcagatggagtgttcat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18504965 |
ttgatttctggtattgaaagtaaagctcagatggagtgttcat |
18505007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 3 - 44
Target Start/End: Original strand, 18504786 - 18504827
Alignment:
| Q |
3 |
aataaaagaacgatagatacctttttaatgttaataataata |
44 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18504786 |
aataaaagaaggatagatacctttttaatgttaataataata |
18504827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University