View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1364_high_73 (Length: 221)

Name: NF1364_high_73
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1364_high_73
NF1364_high_73
[»] chr5 (1 HSPs)
chr5 (14-203)||(6966326-6966515)


Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 14 - 203
Target Start/End: Original strand, 6966326 - 6966515
Alignment:
14 agaatatgagagcaaaagtcagaatttaatgtccatatcgcatattcatagtttaaaatctgcagaaggacggnnnnnnnggcttaggcttttgaattta 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||    
6966326 agaatatgagagcaaaagtcagaatttaatgtccatatcgcatattcatagtttaaaatctgcagaaggacggaaaaaatggcttaggcttttgaattta 6966425  T
114 taacttaatttttcttctttacacttgctattccacaggtttttggtaacagtgatgggtttggcaattccatggagcataacattgttc 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6966426 taacttaatttttcttctttacacttgctattccacaggtttttggtaacagtgatgggtttggcaattccatggagcataacattgttc 6966515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University