View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364_high_78 (Length: 214)
Name: NF1364_high_78
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364_high_78 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 79 - 214
Target Start/End: Original strand, 6966326 - 6966461
Alignment:
| Q |
79 |
agaatatgagagcaaaagtcagaatttaatgtccatatcgcatattcatagtttaaaatctgcagaaggacggnnnnnnnggcttaggcttttgaattta |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6966326 |
agaatatgagagcaaaagtcagaatttaatgtccatatcgcatattcatagtttaaaatctgcagaaggacggaaaaaatggcttaggcttttgaattta |
6966425 |
T |
 |
| Q |
179 |
taacttaatttttcttctttacacttgctattccac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6966426 |
taacttaatttttcttctttacacttgctattccac |
6966461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University