View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364_high_82 (Length: 208)
Name: NF1364_high_82
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364_high_82 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 13396811 - 13396889
Alignment:
| Q |
1 |
tgccaatgtctcgcttcatccagaccattagacacatcaaacttccaagttctgaagcatatggaatcctagcaattaa |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13396811 |
tgccaatgtctcgcttcatccagaccattacatacatcaaacttccaagttctgaagcatatggaatcctagccattaa |
13396889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University