View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364_low_109 (Length: 204)
Name: NF1364_low_109
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364_low_109 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 5e-49; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 10397301 - 10397419
Alignment:
| Q |
1 |
gtgggattgtgtcagaggattcttcaatattgatgaaatagggttcattgaaggacgacatggatgatatgaatgagattatgagtgattatctagtagg |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | | ||||| |
|
|
| T |
10397301 |
gtgggatggtgtcagaggattcttcaatattgatgaaatagggttcattggaggacgacatggatgatatgaatgagattatgagtgattctttcgtagg |
10397400 |
T |
|
| Q |
101 |
gttaaagaatttgaagaat |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
10397401 |
gttaaagaatttgaagaat |
10397419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 10407521 - 10407635
Alignment:
| Q |
1 |
gtgggattgtgtcagaggattcttcaatattgatgaaatagggttcattgaaggacgacatggatgatatgaatgagattatgagtgattatctagtagg |
100 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| | | ||||| |
|
|
| T |
10407521 |
gtgggatggtgtcagagggttcttcaatattgatgaaatagggttcattggaggacgacatggatgatataaatgagattatgagtgattctttcgtagg |
10407620 |
T |
|
| Q |
101 |
gttaaagaatttgaa |
115 |
Q |
| |
|
||||| || |||||| |
|
|
| T |
10407621 |
gttaatgagtttgaa |
10407635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 10402166 - 10402285
Alignment:
| Q |
1 |
gtgggattgtgtcagaggattcttcaatattgatgaaatagggttcattgaaggacgacatggatgatatgaatgagattatgagtgattatct-agtag |
99 |
Q |
| |
|
||||||| ||||||||||||| ||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | | ||| |
|
|
| T |
10402166 |
gtgggatgatgtcagaggattcctcaatatggatgaaatagggttcattggaggacgacatggatgatatgaatgagattatgagtgattctttccatag |
10402265 |
T |
|
| Q |
100 |
ggttaaagaatttgaagaat |
119 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
10402266 |
ggttaaagaatttgaagaat |
10402285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 17 - 111
Target Start/End: Original strand, 10429642 - 10429736
Alignment:
| Q |
17 |
ggattcttcaatattgatgaaatagggttcattgaaggacgacatggatgatatgaatgagattatgagtgattatctagtagggttaaagaatt |
111 |
Q |
| |
|
|||||| ||||||| ||| ||||||| |||| | ||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||| |
|
|
| T |
10429642 |
ggattcctcaatatagataaaataggattcagtagaggacgacatggatgatatgaatgagattatgagtgattcttcactagggttaaagaatt |
10429736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University