View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364_low_28 (Length: 390)
Name: NF1364_low_28
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 137 - 375
Target Start/End: Complemental strand, 42183277 - 42183039
Alignment:
| Q |
137 |
cattccacctgctgtgacaacaacaaacacaagtatgttcagacttcagaaacttgtacagaacnnnnnnngttctgatcactacttatttttctatata |
236 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
42183277 |
cattccacctgctgtgacaaccacaaacacaagtatgttcagacttcagaaacttgtacagaactttttttgttctgaccactacttatgtttctatata |
42183178 |
T |
|
| Q |
237 |
ttattgattgatggaaaacaataagaaataaacacaaattaacctttgagggttgtgttggaggcagaaatgttgtgaaaaggttgaaaatttaaggata |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42183177 |
ttattgattgatggaaaacaataagaaataaacacaaattaacctttgagggttgtgttggaggcagaaatgttgtgaaaaggttgaaaatttaaggata |
42183078 |
T |
|
| Q |
337 |
caccgccattatcaatgatagcattagcacctagagcag |
375 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42183077 |
caccaccattatcaatgatagcattagcacctagagcag |
42183039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University