View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364_low_34 (Length: 375)
Name: NF1364_low_34
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364_low_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 83 - 277
Target Start/End: Complemental strand, 41555854 - 41555660
Alignment:
| Q |
83 |
gagcagagagaaatcaatgattgggatggaagctgcaatctcatctgcaacatcaataatatcaccatgttctgtgagggagtggtaattggaaggaatg |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41555854 |
gagcagagagaaatcaatgattgggatggaagctgcaatctcatctgcaacatcaataatatcaccatgttctgtgagggagtggtaattggaaggaatg |
41555755 |
T |
|
| Q |
183 |
agagaggttccatttgattccgcaaaggctttgatgcttgaaatatttgatgtatgaacctttgttggttctgatgatgaaattgtagtagctga |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41555754 |
agagaggttccatttgattccgcaaaggctttgatgcttgaaatatttgatgtatgaacctttgttggttctgatgatgaaattgtagtagctga |
41555660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 87 - 181
Target Start/End: Complemental strand, 41560502 - 41560408
Alignment:
| Q |
87 |
agagagaaatcaatgattgggatggaagctgcaatctcatctgcaacatcaataatatcaccatgttctgtgagggagtggtaattggaaggaat |
181 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||| |||| |||||||| ||||||| || |||||| ||||||||||||| | |||||||| |
|
|
| T |
41560502 |
agagagaaatcaatgactgggatggaagctgcaagctcctctgtaacatcaacaatatcatcaggttctgcgagggagtggtaacttgaaggaat |
41560408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 206 - 265
Target Start/End: Complemental strand, 41560404 - 41560345
Alignment:
| Q |
206 |
aaaggctttgatgcttgaaatatttgatgtatgaacctttgttggttctgatgatgaaat |
265 |
Q |
| |
|
|||||||||||| |||||||||||||||| || ||| ||||| ||||||||||||||||| |
|
|
| T |
41560404 |
aaaggctttgatacttgaaatatttgatgcatcaacttttgtaggttctgatgatgaaat |
41560345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University