View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364_low_47 (Length: 296)
Name: NF1364_low_47
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364_low_47 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 138 - 296
Target Start/End: Complemental strand, 30023151 - 30022994
Alignment:
| Q |
138 |
aacattacaaacatgctccccacctccaaagtataataatgttaagtatgtgctgtctttcgtcgtgtgttaatctgaatctggaaaatgagatcagnnn |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30023151 |
aacattacaaacatgctccccacctccaaagtataataatgttaagtatgtgctgtctttcgtcgtgtgttaatctgaatctggaaaatgagatcag-tt |
30023053 |
T |
|
| Q |
238 |
nnnnnnngccattttgttagttgttaccacaccatgtgcatgccagttgtttcaatctt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30023052 |
tttttttgccattttgttagttgttaccacaccatgtgcatgccagttgtttcaatctt |
30022994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 18 - 139
Target Start/End: Complemental strand, 30023302 - 30023181
Alignment:
| Q |
18 |
ggtcaagaagtgatgaggaagaagctaagcttatgtttgatgtcaggatcagttgcaattttttaaatgtagcttttaaaaaattaagatgaatcgtcgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30023302 |
ggtcaagaagtgatgaggaagaagctaagcttatgtttgatgtcaggatcggttgcaattttttaaatgtagtttttaaaaaattaagatgaatcgtcgt |
30023203 |
T |
|
| Q |
118 |
gattgtgacatattcaccctaa |
139 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
30023202 |
gattttgacatattcaccctaa |
30023181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University