View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364_low_49 (Length: 291)
Name: NF1364_low_49
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364_low_49 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 74 - 175
Target Start/End: Complemental strand, 8780365 - 8780264
Alignment:
| Q |
74 |
gttctcaccaattcatatctcatggatcgatctaacaccatgctctagttattacctcggtgcgtgcttgtggtcttaaaagtctcggtgttaatgaacc |
173 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| | | ||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
8780365 |
gttctcaccaattcatatcccatggatctatctaacaccatgctctagttattacctcaattcttgcttgtggtcttaaaagtcttggtgttaattaacc |
8780266 |
T |
|
| Q |
174 |
ct |
175 |
Q |
| |
|
|| |
|
|
| T |
8780265 |
ct |
8780264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 74 - 175
Target Start/End: Complemental strand, 8791860 - 8791759
Alignment:
| Q |
74 |
gttctcaccaattcatatctcatggatcgatctaacaccatgctctagttattacctcggtgcgtgcttgtggtcttaaaagtctcggtgttaatgaacc |
173 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| | | ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
8791860 |
gttctcaccaattcatatcccatggatctatctaacaccatgctctagttattacctcaattcttgcttgtggtcttaaaagtcttcgtgttaattaacc |
8791761 |
T |
|
| Q |
174 |
ct |
175 |
Q |
| |
|
|| |
|
|
| T |
8791760 |
ct |
8791759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 183 - 235
Target Start/End: Complemental strand, 38614571 - 38614519
Alignment:
| Q |
183 |
taaaatatgtgattagcttctgaatttgaaaaataagcatgtgatctcttcat |
235 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||||||| |||| | ||||||| |
|
|
| T |
38614571 |
taaaatatgtgattggcttttggatttgaaaaataagcttgtgctttcttcat |
38614519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 183 - 225
Target Start/End: Original strand, 14195868 - 14195910
Alignment:
| Q |
183 |
taaaatatgtgattagcttctgaatttgaaaaataagcatgtg |
225 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
14195868 |
taaaacatgtgattagcttgtgaatttgaaaaataagcttgtg |
14195910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University