View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1364_low_51 (Length: 286)

Name: NF1364_low_51
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1364_low_51
NF1364_low_51
[»] chr7 (1 HSPs)
chr7 (69-261)||(35146299-35146491)


Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 69 - 261
Target Start/End: Original strand, 35146299 - 35146491
Alignment:
69 cacttttgcttcatgtgaatttcccaaaaatgatcacttctacatttatttcttagacaaatgcatacttcagacattttgatgagttctattggtgaaa 168  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35146299 cacttttgcttcatgtgaatttcccaaaaatgatcacttctacatttatttcttagacaaatgcatacttcagacattttgatgagttctattggtgaaa 35146398  T
169 gacgttcgagaattccatctaaaatggattcgggaaaattcaaaagagagatgctaacactatttgcaattttcttcattctagtttcctttg 261  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35146399 gacgttcgagaattccatctaaaatggattcgggaaaattcaaaagagagatgctaacactatttgcaattttcttcattctagtttcctttg 35146491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University