View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1364_low_60 (Length: 264)

Name: NF1364_low_60
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1364_low_60
NF1364_low_60
[»] chr4 (1 HSPs)
chr4 (53-103)||(46565308-46565358)


Alignment Details
Target: chr4 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 53 - 103
Target Start/End: Original strand, 46565308 - 46565358
Alignment:
53 cttatatgacaaagagtgcatgttgtgcagcttcaagactttcgttcttca 103  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
46565308 cttatatgacaaagagtgcatgttgtgcagcttcaagactttcgttcttca 46565358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University