View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364_low_66 (Length: 253)
Name: NF1364_low_66
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364_low_66 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 30 - 253
Target Start/End: Original strand, 3410432 - 3410655
Alignment:
| Q |
30 |
gtatgatcccaccattgttgtcaaagttgggatcctgcttaagatcatgagggggtaaaagatcataatttagataatcgtaaaattatacctatattat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3410432 |
gtatgatcccaccattgttgtcaaagttgggatcctgcttaagatcatgagggggtaaaagatcataatttagataatcgtaaaattatacctatattat |
3410531 |
T |
|
| Q |
130 |
aaaatcataccnnnnnnnnnnnnnnnnnnnntgaaaaataacataaacaggaaaatgaaacttaaattatgacattataccaacttaaagttgtgtactt |
229 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3410532 |
aaaatcatacccacacacacacaaacacacatgaaaaataacataaacaggaaaatgaaacttaaattatgacattataccaacttaaagttgtgtactt |
3410631 |
T |
|
| Q |
230 |
ttaggtatcatggttaaaattgga |
253 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3410632 |
ttaggtatcatggttaaaattgga |
3410655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 216 - 250
Target Start/End: Original strand, 14417754 - 14417788
Alignment:
| Q |
216 |
aaagttgtgtacttttaggtatcatggttaaaatt |
250 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14417754 |
aaagtagtgtacttttaggtatcatggttaaaatt |
14417788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University