View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364_low_68 (Length: 252)
Name: NF1364_low_68
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364_low_68 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 10 - 100
Target Start/End: Original strand, 5373421 - 5373512
Alignment:
| Q |
10 |
agatgaaagctagatttgaaaggatgaaacagacaggatcggaaaa-acagatgcatatataataggaaacgggagaaagttattagaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5373421 |
agatgaaagctagatttgaaaggatgaaacagacaggatcggaaaaaacagatgcatatataataggaaacgggagaaagttattagaaaat |
5373512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 127 - 179
Target Start/End: Original strand, 5373539 - 5373590
Alignment:
| Q |
127 |
aacacagatgttgatgatgatgtgtctgattgagaaattttaggagatttgag |
179 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5373539 |
aacacagatgtt-atgatgatgtgtctgattgagaaattttacgagatttgag |
5373590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University