View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364_low_71 (Length: 251)
Name: NF1364_low_71
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364_low_71 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 29 - 74
Target Start/End: Complemental strand, 3649187 - 3649142
Alignment:
| Q |
29 |
acgaggatgaactaggattcattttctgttttagatttcttcaacc |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3649187 |
acgaggatgaactaggattcattttctgttttagatttcttcaacc |
3649142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 3649009 - 3648965
Alignment:
| Q |
207 |
aatgtcacatgaatttcaaatatacaaaacataatgacataaccc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3649009 |
aatgtcacatgaatttcaaatatacaaaacataatgacataaccc |
3648965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University