View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364_low_82 (Length: 238)
Name: NF1364_low_82
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364_low_82 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 19 - 122
Target Start/End: Original strand, 8780262 - 8780365
Alignment:
| Q |
19 |
atagggttcattaacaccgagacttttaagaccacaagcaagcaccgaggtaataactagagcatggtgttagatagatccatgagatatgaattggtga |
118 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8780262 |
atagggttaattaacaccaagacttttaagaccacaagcaagaattgaggtaataactagagcatggtgttagatagatccatgggatatgaattggtga |
8780361 |
T |
|
| Q |
119 |
gaac |
122 |
Q |
| |
|
|||| |
|
|
| T |
8780362 |
gaac |
8780365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 19 - 122
Target Start/End: Original strand, 8791757 - 8791860
Alignment:
| Q |
19 |
atagggttcattaacaccgagacttttaagaccacaagcaagcaccgaggtaataactagagcatggtgttagatagatccatgagatatgaattggtga |
118 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8791757 |
atagggttaattaacacgaagacttttaagaccacaagcaagaattgaggtaataactagagcatggtgttagatagatccatgggatatgaattggtga |
8791856 |
T |
|
| Q |
119 |
gaac |
122 |
Q |
| |
|
|||| |
|
|
| T |
8791857 |
gaac |
8791860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University