View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364_low_87 (Length: 231)
Name: NF1364_low_87
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364_low_87 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 21 - 102
Target Start/End: Complemental strand, 50427848 - 50427767
Alignment:
| Q |
21 |
gaaggtgtaggccacatagaggatgatcaatgtgaagatgaagaaaaatgagctggaagtgaggtttagtggattgaccatg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50427848 |
gaaggtgtaggccacatagaggatgatcaatgtgaagatgaagaaaaatgagctggaagtgaggtttagtggattgaccatg |
50427767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 83
Target Start/End: Complemental strand, 50422675 - 50422613
Alignment:
| Q |
21 |
gaaggtgtaggccacatagaggatgatcaatgtgaagatgaagaaaaatgagctggaagtgag |
83 |
Q |
| |
|
|||||| ||||| ||||||| |||| ||||||||||||||||||| || || |||||||||| |
|
|
| T |
50422675 |
gaaggtataggctacatagatgatggtcaatgtgaagatgaagaagaagaagttggaagtgag |
50422613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University