View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364_low_88 (Length: 227)
Name: NF1364_low_88
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364_low_88 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 30 - 124
Target Start/End: Original strand, 24929323 - 24929420
Alignment:
| Q |
30 |
gcagtttcatatgaaatgtgaaactttgtcttgttggcattcaaatgtttgaaatggaagacaagaaacacattcaaa---aataaaagatttataga |
124 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
24929323 |
gcagtttcatttgatatgtgaaactttgtcttgttggcattcaaatgtttgaaacggaagacaagaaacacattaaaaaataataaaagatttataga |
24929420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 200
Target Start/End: Original strand, 24929465 - 24929501
Alignment:
| Q |
164 |
aacaagagatttgaattcaattcttgcggtttgttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24929465 |
aacaagagatttgaattcaattcttgcggtttattta |
24929501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University