View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1364_low_94 (Length: 221)
Name: NF1364_low_94
Description: NF1364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1364_low_94 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 14 - 203
Target Start/End: Original strand, 6966326 - 6966515
Alignment:
| Q |
14 |
agaatatgagagcaaaagtcagaatttaatgtccatatcgcatattcatagtttaaaatctgcagaaggacggnnnnnnnggcttaggcttttgaattta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6966326 |
agaatatgagagcaaaagtcagaatttaatgtccatatcgcatattcatagtttaaaatctgcagaaggacggaaaaaatggcttaggcttttgaattta |
6966425 |
T |
 |
| Q |
114 |
taacttaatttttcttctttacacttgctattccacaggtttttggtaacagtgatgggtttggcaattccatggagcataacattgttc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6966426 |
taacttaatttttcttctttacacttgctattccacaggtttttggtaacagtgatgggtttggcaattccatggagcataacattgttc |
6966515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University