View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13651_high_1 (Length: 243)
Name: NF13651_high_1
Description: NF13651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13651_high_1 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 28103244 - 28103020
Alignment:
| Q |
18 |
aagacattgattgtgatcttgggaattttgagaattacttggattagggtatctttgagcattagagtgtgatattattgggttcttcaattgaggattt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28103244 |
aagacattgattgtgatcttgggaattttgagaat-acttggattagggtatctttgagcattagagtgtgatattattgggttcttcaattgaggattt |
28103146 |
T |
 |
| Q |
118 |
tcttcatttattccgtgcatcttcaattgacattttgtcaagaatcaaatgaggatcaaaggtcaagcaacttatacgatcaaaggaggttcaaagggtt |
217 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28103145 |
tcttcatttattccgttcatcttcaattgacattttgtcaagaatcaaatgaggatcaaaggtcaagtaacttatacgatcaaaggaggttcaaagggtt |
28103046 |
T |
 |
| Q |
218 |
gagtagctcatcctatcaaaggaaac |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
28103045 |
gagtagctcatcctatcaaaggaaac |
28103020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University