View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13652_high_1 (Length: 345)
Name: NF13652_high_1
Description: NF13652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13652_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 285
Target Start/End: Complemental strand, 52512102 - 52511836
Alignment:
| Q |
18 |
cacaagatgtttatgaatttactgaatgtcctaattgttatggtatcattcattcttctactttgctcatttcnnnnnnnncttagtaaacgactaaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
52512102 |
cacaagatgtttatgaatttactgaatgtcctaattgttatggtatcattcattcttctaatttgctcatttcttttttt-cttagtaaacgactaaatt |
52512004 |
T |
 |
| Q |
118 |
gacagattttccgtaggtcgaggaaagcttgtctgccctgtttgtttaggaactggtgtgccaaacaataaaggtcttctcaggaggcctgacgcaaaga |
217 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52512003 |
gactgattttccgtaggtcgaggaaagcttgtctgccctgtttgtttaggaactggtgtgccaaacaataaaggtcttctcaggaggcctgacgcaaaga |
52511904 |
T |
 |
| Q |
218 |
aactgcttgataagatgtataatggacgcctacttccaaattcttagaaggtatgtatactactcatg |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52511903 |
aactgcttgataagatgtataatggacgcctacttcccaattcttagaaggtatgtatactactcatg |
52511836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 295 - 345
Target Start/End: Complemental strand, 52511795 - 52511742
Alignment:
| Q |
295 |
atgttaatcttctgttgctgctgctg---ttatattcactgtactacatccttt |
345 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52511795 |
atgttaatcttctgttgctgctgctgctgttatattcactgtactacatccttt |
52511742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University