View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13653_high_11 (Length: 361)
Name: NF13653_high_11
Description: NF13653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13653_high_11 |
 | |
|
| [»] scaffold0016 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 154 - 343
Target Start/End: Original strand, 27511586 - 27511775
Alignment:
| Q |
154 |
catctacctgagacaagaccattgcggttagtgtcagcgttctgaggcatgccactagtattaaaaggggcgaaggggctaatgagatggggattggctt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27511586 |
catctacctgagacaagaccattgcggttagtgtcagcgttctgaggcatgccactagtattaaaaggggcgaaggggctaatgagatggggattggctt |
27511685 |
T |
|
| Q |
254 |
taaaatagcggtaagaggggcgaaggacagacaagacgatggggtaaaggtaagactttgagatgagaccgggggaggagactgtgagag |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27511686 |
taaaatagcggtaagaggggcgaaggacagacaagacgatggggtaaaggtaagactttgagatgagaccgggggaggagactgtgagag |
27511775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 7 - 64
Target Start/End: Original strand, 27511445 - 27511502
Alignment:
| Q |
7 |
tgattcgaatcacctttttgttgaagacaacttgtttcatgaacagatcaaacacagc |
64 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
27511445 |
tgattcgaatcacctttttgttgaagacgacttgattcatgaacagatcaaacacagc |
27511502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 155 - 338
Target Start/End: Complemental strand, 77584 - 77388
Alignment:
| Q |
155 |
atctacctgagacaagaccattgcggttagtgtcagcgttctgaggcatgccactagtattaaaaggggcgaaggggctaatgagatggggattggcttt |
254 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||| ||||| || ||||||||| | ||| ||||| ||||| ||||| | |||||||||||||||||| |
|
|
| T |
77584 |
atctacctgatacaagaccattgcggtgagtgtccgcgttttggggcatgccattgatatcaaaagaggcgacagggcttaggagatggggattggcttt |
77485 |
T |
|
| Q |
255 |
aaaatagcggtaaga------------ggggcgaaggacagacaaga-cgatggggtaaaggtaagactttgagatgagaccgggggaggagactgt |
338 |
Q |
| |
|
||||||||||| || ||| |||| |||||| |||| | ||||| | ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
77484 |
gaaatagcggtaggaggaactagcgacgggacgaatgacagaaaagacccatgggatgaagataagactttgagatgagaccgggggaggagactgt |
77388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University