View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13653_high_7 (Length: 475)
Name: NF13653_high_7
Description: NF13653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13653_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 424; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 424; E-Value: 0
Query Start/End: Original strand, 1 - 460
Target Start/End: Complemental strand, 23596656 - 23596198
Alignment:
| Q |
1 |
gaaaaaaccaaactgctgtccgggtcgcctcatctccaaccactgaaaaatcccccacgggttttggttcagtggttatgatggacgacccgttaacagc |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23596656 |
gaaaaaaccaaaccgctgtccgggtcgcctcatctccaaccactgaaaaatcccccacgggttttggttcagtggttatgatggacgacccgttaacagc |
23596557 |
T |
|
| Q |
101 |
ccgtccggagtcaaattccgaagttgtgggaagagcacaaggaatctatgcttcagcttcacaaagtgaagttgggtttctcatggtgcttaattttgct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
23596556 |
ccgtccggagtcaaattccgaagttgtgggaagagcacaaggaatctatgcttcagcttcacaaagtgaagttgggtttctcatggtgcttaactttgct |
23596457 |
T |
|
| Q |
201 |
ttcacacaagggaagtacaatggaagtaatctcagtattttgggcaggaatacaattgaatccgccgtgagagagatgccggttgtgggtggaagtgggc |
300 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23596456 |
ttcacacaagggaagtataatggaagtaatctcagtattttgggaaggaatacgatcgaatccgccgtgagagagatgccggttgtgggtggtagtgggc |
23596357 |
T |
|
| Q |
301 |
tgttcagatttgcaagggggtatgctcaggcttctactcattctataaatgcattagaagctattgtggagtataatgtttatgtctttcattattaaga |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23596356 |
tgttcagatttgcaagggggtatgctcaggcttctactcattctataaatgcattagaagctattgtggagtataatgtttatgtctttcattattaaga |
23596257 |
T |
|
| Q |
401 |
ttaagatgagattcataatcaattttagttgttaatttctttatgtagttttgtatcatt |
460 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23596256 |
ttaagatgagattcataatcaattttagttgttaattt-tttatgtagttttgtatcatt |
23596198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 273 - 342
Target Start/End: Complemental strand, 3762536 - 3762467
Alignment:
| Q |
273 |
gagatgccggttgtgggtggaagtgggctgttcagatttgcaagggggtatgctcaggcttctactcatt |
342 |
Q |
| |
|
|||||||| ||||| ||||| ||||| || ||||||||||| || || |||||||| ||| ||||||||| |
|
|
| T |
3762536 |
gagatgcctgttgttggtggcagtggacttttcagatttgctagaggatatgctcaagctactactcatt |
3762467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University