View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13653_low_13 (Length: 331)
Name: NF13653_low_13
Description: NF13653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13653_low_13 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 310; Significance: 1e-175; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 310; E-Value: 1e-175
Query Start/End: Original strand, 1 - 331
Target Start/End: Original strand, 52876642 - 52876973
Alignment:
| Q |
1 |
tcaaaaacaaaggcaaaagttgcactgatttttagtcgtaggtttaactttgttgatgacttcatacttccattgattttcttttttatacatttcaccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52876642 |
tcaaaaacaaaggcaaaagttgcactgatttttagtcgtaggtttaactttgttgatgacttcatactttcattgattttcttttttatacatttcaccc |
52876741 |
T |
 |
| Q |
101 |
tcttgtctacatacttaaaaatgaacatgttgacgtatgcacaaacacatatagtgcattttttccaacaaagtttcttgtgattgtgtattgtcattga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52876742 |
tcttgtctacatacttaaaaatgaacatgttgacgtatgcacaaacacatatagtgcattttttccaacaaagtttcttgtgattgtgtattgtcattga |
52876841 |
T |
 |
| Q |
201 |
caaactttatacgttgcttgattccataacaaactttctacaacaacgcattgaaaaatggtttgttgttgtctc--taatgatttttacaactcactca |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
52876842 |
caaactttatacgttgcttgattccataacaaactttctacaacaacgcattgaaaaatggttt-ttgttgtctcaataatgatttttacaactcactca |
52876940 |
T |
 |
| Q |
299 |
tgatagagatatttattgaatctatttgatttt |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
52876941 |
tgatagagatatttattgaatctatttgatttt |
52876973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University